Finding Regulatory Motifs in DNA Sequences Outline Implanting Patterns in R in addition to om

Finding Regulatory Motifs in DNA Sequences Outline Implanting Patterns in R in addition to om www.phwiki.com

Finding Regulatory Motifs in DNA Sequences Outline Implanting Patterns in R in addition to om

Walker, Stephanie, Meteorologist has reference to this Academic Journal, PHwiki organized this Journal Finding Regulatory Motifs in DNA Sequences Outline Implanting Patterns in R in addition to om Text Gene Regulation Regulatory Motifs The Gold Bug Problem The Motif Finding Problem Brute Force Motif Finding The Median String Problem Search Trees Branch- in addition to -Bound Motif Search Branch- in addition to -Bound Median String Search Consensus in addition to Pattern Branching: Greedy Motif Search PMS: Exhaustive Motif Search R in addition to om Sample atgaccgggatactgataccgtatttggcctaggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatactgggcataaggtaca tgagtatccctgggatgacttttgggaacactatagtgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgaccttgtaagtgttttccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatggcccacttagtccacttatag gtcaatcatgttcttgtgaatggatttttaactgagggcatagaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgtactgatggaaactttcaattatgagagagctaatctatcgcgtgcgtgttcat aacttgagttggtttcgaaaatgctctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatttcaacgtatgccgaaccgaaagggaag ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttctgggtactgatagca

Institut Suprieur d'Agriculture Lille FR www.phwiki.com

This Particular University is Related to this Particular Journal

Implanting Motif AAAAAAAGGGGGGG atgaccgggatactgatAAAAAAAAGGGGGGGggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaataAAAAAAAAGGGGGGGa tgagtatccctgggatgacttAAAAAAAAGGGGGGGtgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgAAAAAAAAGGGGGGGtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatAAAAAAAAGGGGGGGcttatag gtcaatcatgttcttgtgaatggatttAAAAAAAAGGGGGGGgaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgtAAAAAAAAGGGGGGGcaattatgagagagctaatctatcgcgtgcgtgttcat aacttgagttAAAAAAAAGGGGGGGctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatAAAAAAAAGGGGGGGaccgaaagggaag ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttAAAAAAAAGGGGGGGa Where is the Implanted Motif atgaccgggatactgataaaaaaaagggggggggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaataaaaaaaaaggggggga tgagtatccctgggatgacttaaaaaaaagggggggtgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgaaaaaaaagggggggtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaataaaaaaaagggggggcttatag gtcaatcatgttcttgtgaatggatttaaaaaaaaggggggggaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgtaaaaaaaagggggggcaattatgagagagctaatctatcgcgtgcgtgttcat aacttgagttaaaaaaaagggggggctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcataaaaaaaagggggggaccgaaagggaag ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttaaaaaaaaggggggga Implanting Motif AAAAAAGGGGGGG with Four Mutations atgaccgggatactgatAgAAgAAAGGttGGGggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacAAtAAAAcGGcGGGa tgagtatccctgggatgacttAAAAtAAtGGaGtGGtgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgcAAAAAAAGGGattGtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatAtAAtAAAGGaaGGGcttatag gtcaatcatgttcttgtgaatggatttAAcAAtAAGGGctGGgaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgtAtAAAcAAGGaGGGccaattatgagagagctaatctatcgcgtgcgtgttcat aacttgagttAAAAAAtAGGGaGccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatActAAAAAGGaGcGGaccgaaagggaag ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttActAAAAAGGaGcGGa

Where is the Motif atgaccgggatactgatagaagaaaggttgggggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacaataaaacggcggga tgagtatccctgggatgacttaaaataatggagtggtgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgcaaaaaaagggattgtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatataataaaggaagggcttatag gtcaatcatgttcttgtgaatggatttaacaataagggctgggaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgtataaacaaggagggccaattatgagagagctaatctatcgcgtgcgtgttcat aacttgagttaaaaaatagggagccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatactaaaaaggagcggaccgaaagggaag ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttactaaaaaggagcgga Why Finding (15,4) Motif is Difficult atgaccgggatactgatAgAAgAAAGGttGGGggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacAAtAAAAcGGcGGGa tgagtatccctgggatgacttAAAAtAAtGGaGtGGtgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgcAAAAAAAGGGattGtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatAtAAtAAAGGaaGGGcttatag gtcaatcatgttcttgtgaatggatttAAcAAtAAGGGctGGgaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgtAtAAAcAAGGaGGGccaattatgagagagctaatctatcgcgtgcgtgttcat aacttgagttAAAAAAtAGGGaGccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatActAAAAAGGaGcGGaccgaaagggaag ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttActAAAAAGGaGcGGa AgAAgAAAGGttGGG cAAtAAAAcGGcGGG . Challenge Problem Find a motif in a sample of – 20 “r in addition to om” sequences (e.g. 600 nt long) – each sequence containing an implanted pattern of length 15, – each pattern appearing with 4 mismatches as (15,4)-motif.

Combinatorial Gene Regulation A microarray experiment showed that when gene X is knocked out, 20 other genes are not expressed How can one gene have such drastic effects Regulatory Proteins Gene X encodes regulatory protein, a.k.a. a transcription factor (TF) The 20 unexpressed genes rely on gene X’s TF to induce transcription A single TF may regulate multiple genes Regulatory Regions Every gene contains a regulatory region (RR) typically stretching 100-1000 bp upstream of the transcriptional start site Located within the RR are the Transcription Factor Binding Sites (TFBS), also known as motifs, specific as long as a given transcription factor TFs influence gene expression by binding to a specific location in the respective gene’s regulatory region – TFBS

Transcription Factor Binding Sites A TFBS can be located anywhere within the Regulatory Region. TFBS may vary slightly across different regulatory regions since non-essential bases could mutate Motifs in addition to Transcriptional Start Sites gene ATCCCG gene TTCCGG gene ATCCCG gene ATGCCG gene ATGCCC Transcription Factors in addition to Motifs

Motif Logo Motifs can mutate on non important bases The five motifs in five different genes have mutations in position 3 in addition to 5 Representations called motif logos illustrate the conserved in addition to variable regions of a motif TGGGGGA TGAGAGA TGGGGGA TGAGAGA TGAGGGA Motif Logos: An Example (http://www-lmmb.ncifcrf.gov/~toms/sequencelogo.html) Identifying Motifs Genes are turned on or off by regulatory proteins These proteins bind to upstream regulatory regions of genes to either attract or block an RNA polymerase Regulatory protein (TF) binds to a short DNA sequence called a motif (TFBS) So finding the same motif in multiple genes’ regulatory regions suggests a regulatory relationship amongst those genes

Identifying Motifs: Complications We do not know the motif sequence We do not know where it is located relative to the genes start Motifs can differ slightly from one gene to the next How to discern it from “r in addition to om” motifs A Motif Finding Analogy The Motif Finding Problem is similar to the problem posed by Edgar Allan Poe (1809 – 1849) in his Gold Bug story The Gold Bug Problem Given a secret message: 53++!305))6;4826)4+.)4+);806;48!8`60))85;]8:+8!83(88)5!; 46(;8896;8)+(;485);5!2:+(;49562(5-4)8`8; 4069285);)6 !8)4++;1(+9;48081;8:8+1;48!85;4)485!52880681(+9;48;(88;4(+3 4;48)4+;161;:188;+; Decipher the message encrypted in the fragment

Hints as long as The Gold Bug Problem Additional hints: The encrypted message is in English Each symbol correspond to one letter in the English alphabet No punctuation marks are encoded The Gold Bug Problem: Symbol Counts Naive approach to solving the problem: Count the frequency of each symbol in the encrypted message Find the frequency of each letter in the alphabet in the English language Compare the frequencies of the previous steps, try to find a correlation in addition to map the symbols to a letter in the alphabet Symbol Frequencies in the Gold Bug Message Gold Bug Message: English Language: e t a o i n s r h l d c u m f p g w y b v k x j q z Most frequent Least frequent

Walker, Stephanie NBC 13 News at 11 AM - WVTM-TV Meteorologist www.phwiki.com

The Gold Bug Message Decoding: First Attempt By simply mapping the most frequent symbols to the most frequent letters of the alphabet: sfiilfcsoorntaeuroaikoaiotecrntaeleyrcooestvenpinelefheeosnlt arhteenmrnwteonihtaesotsnlupnihtamsrnuhsnbaoeyentacrmuesotorl eoaiitdhimtaecedtepeidtaelestaoaeslsueecrnedhimtaetheetahiwfa taeoaitdrdtpdeetiwt The result does not make sense The Gold Bug Problem: l-tuple count A better approach: Examine frequencies of l-tuples, combinations of 2 symbols, 3 symbols, etc. “The” is the most frequent 3-tuple in English in addition to “;48” is the most frequent 3-tuple in the encrypted text Make inferences of unknown symbols by examining other frequent l-tuples The Gold Bug Problem: the ;48 clue Mapping “the” to “;48” in addition to substituting all occurrences of the symbols: 53++!305))6the26)h+.)h+)te06the!e`60))e5t]e:+e!e3(ee)5!t h6(tee96te)+(the5)t5!2:+(th9562(5h)e`eth0692e5)t)6!e )h++t1(+9the0e1te:e+1the!e5th)he5!52ee06e1(+9thet(eeth(+3ht he)h+t161t:1eet+t

The Gold Bug Message Decoding: Second Attempt Make inferences: 53++!305))6the26)h+.)h+)te06the!e`60))e5t]e:+e!e3(ee)5!t h6(tee96te)+(the5)t5!2:+(th9562(5h)e`eth0692e5)t)6!e )h++t1(+9the0e1te:e+1the!e5th)he5!52ee06e1(+9thet(eeth(+3ht he)h+t161t:1eet+t “thet(ee” most likely means “the tree” Infer “(“ = “r” “th(+3h” becomes “thr+3h” Can we guess “+” in addition to “” The Gold Bug Problem: The Solution After figuring out all the mappings, the final message is: AGOODGLASSINTHEBISHOPSHOSTELINTHEDEVILSSEATWENYONEDEGRE ESANDTHIRTEENMINUTESNORTHEASTANDBYNORTHMAINBRANCHSEVENT HLIMBEASTSIDESHOOTFROMTHELEFTEYEOFTHEDEATHSHEADABEELINE FROMTHETREETHROUGHTHESHOTFIFTYFEETOUT The Solution (cont’d) Punctuation is important: A GOOD GLASS IN THE BISHOP’S HOSTEL IN THE DEVIL’S SEA, TWENY ONE DEGREES AND THIRTEEN MINUTES NORTHEAST AND BY NORTH, MAIN BRANCH SEVENTH LIMB, EAST SIDE, SHOOT FROM THE LEFT EYE OF THE DEATH’S HEAD A BEE LINE FROM THE TREE THROUGH THE SHOT, FIFTY FEET OUT.

Eliminate duplicates AAG AGT GTC TCA CAG AGG GGA GAG AGT AAA AAT ATC ACA AAG AAG AGA AAG AAT AAC ACT CTC CCA CAA ACG CGA CAG ACT AAT AGA GAC GCA CAC AGA GAA GAA AGA ACG AGC GCC TAA CAT AGC GCA GAC AGC AGG AGG GGC TCC CCG AGT GGC GAT AGG ATG ATT GTA TCG CGG ATG GGG GCG ATT CAG CGT GTG TCT CTG CGG GGT GGG CGT GAG GGT GTT TGA GAG GGG GTA GTG GGT TAG TGT TTC TTA TAG TGG TGA TAG TGT Find motif common to all lists Follow this procedure as long as all sequences Find the motif common all Li (once duplicates have been eliminated) This is the planted motif PMS Running Time It takes time to Generate variants Sort lists Find in addition to eliminate duplicates Running time of this algorithm: w is the word length of the computer

Walker, Stephanie Meteorologist

Walker, Stephanie is from United States and they belong to NBC 13 News at 11 AM – WVTM-TV and they are from  Birmingham, United States got related to this Particular Journal. and Walker, Stephanie deal with the subjects like Meteorology

Journal Ratings by Institut Suprieur d’Agriculture Lille

This Particular Journal got reviewed and rated by Institut Suprieur d’Agriculture Lille and short form of this particular Institution is FR and gave this Journal an Excellent Rating.