The Human Genome Project at UC Santa Cruz The Human Genome Project Began in 1990 The genome is our Genetic Blueprint The Genome is Who We Are on the inside!

The Human Genome Project at UC Santa Cruz The Human Genome Project Began in 1990 The genome is our Genetic Blueprint The Genome is Who We Are on the inside! www.phwiki.com

The Human Genome Project at UC Santa Cruz The Human Genome Project Began in 1990 The genome is our Genetic Blueprint The Genome is Who We Are on the inside!

Warren, Lou, Host has reference to this Academic Journal, PHwiki organized this Journal The Human Genome Project at UC Santa Cruz Phoenix Eagleshadow November 9, 2004 The Human Genome Project Began in 1990 The Mission of the HGP: The quest to underst in addition to the human genome in addition to the role it plays in both health in addition to disease. “The true payoff from the HGP will be the ability to better diagnose, treat, in addition to prevent disease.” — Francis Collins, Director of the HGP in addition to the National Human Genome Research Institute (NHGRI) The genome is our Genetic Blueprint Nearly every human cell contains 23 pairs of chromosomes 1 – 22 in addition to XY or XX XY = Male XX = Female Length of chr 1-22, X, Y together is ~3.2 billion bases (about 2 meters diploid)

Carthage College US www.phwiki.com

This Particular University is Related to this Particular Journal

The Genome is Who We Are on the inside! Chromosomes consist of DNA molecular strings of A, C, G, & T base pairs, A-T, C-G Genes DNA sequences that encode proteins less than 3% of human genome In as long as mation coded in DNA CACACTTGCATGTGAGAGCTTCTAATATCTAAATTAATGTTGAATCATTATTCAGAAACAGAGAGCTAACTGTTATCCCATCCTGACTTTATTCTTTATG AGAAAAATACAGTGATTCC AAGTTACCAAGTTAGTGCTGCTTGCTTTATAAATGAAGTAATATTTTAAAAGTTGTGCATAAGTTAAAATTCAGAAATAAAACTTCATCCTAAAACTCTGTGTGTTGCTTTAAATAATC AGAGCATCTGC TACTTAATTTTTTGTGTGTGGGTGCACAATAGATGTTTAATGAGATCCTGTCATCTGTCTGCTTTTTTATTGTAAAACAGGAGGGGTTTTAATACTGGAGGAACAA CTGATGTACCTCTGAAAAGAGA AGAGATTAGTTATTAATTGAATTGAGGGTTGTCTTGTCTTAGTAGCTTTTATTCTCTAGGTACTATTTGATTATGATTGTGAAAATAGAATTTATCC CTCATTAAATGTAAAATCAACAGGAGAATAGCAAAAACTTATGAGATAGATGAACGTTGTGTGAGTGGCATGGTTTAATTTGTTTGGAAGAAGCACTTGCCCCAGAAGATACACAAT GAAATTCATGTTATTGAGTAGAGTAGTAATACAGTGTGTTCCCTTGTGAAGTTCATAACCAAGAATTTTAGTAGTGGATAGGTAGGCTGAATAACTGACTTCCTATC ATTTTCAGGTT CTGCGTTTGATTTTTTTTACATATTAATTTCTTTGATCCACATTAAGCTCAGTTATGTATTTCCATTTTATAAATGAAAAAAAATAGGCACTTGCAAATGTCAGATCACTTGCCTGTGGT CATTCGGGTAGAGATTTGTGGAGCTAAGTTGGTCTTAATCAAATGTCAAGCTTTTTTTTTTCTTATAAAATATAGGTTTTAATATGAGTTTTAAAATAAAATTAATTAGAAAAAGGCAA ATTACTCAATATATATAAGGTATTGCATTTGTAATAGGTAGGTATTTCATTTTCTAGTTATGGTGGGATATTATTCAGACTATAATTCCCAATGAAAAAACTTTAAAAAATGCTAGTGA TTGCACACTTAAAACACCTTTTAAAAAGCATTGAGAGCTTATAAAATTTTAATGAGTGATAAAACCAAATTTGAAGAGAAAAGAAGAACCCAGAGAGGTAAGGATATAACCTTACC AGTTGCAATTTGCCGATCTCTACAAATATTAATATTTATTTTGACAGTTTCAGGGTGAATGAGAAAGAAACCAAAACCCAAGACTAGCATATGTTGTCTTCTTAAGGAGCCCTCCCCT AAAAGATTGAGATGACCAAATCTTATACTCTCAGCATAAGGTGAACCAGACAGACCTAAAGCAGTGGTAGCTTGGATCCACTACTTGGGTTTGTGTGTGGCGTGACTCAGGTAATCT CAAGAATTGAACATTTTTTTAAGGTGGTCCTACTCATACACTGCCCAGGTATTAGGGAGAAGCAAATCTGAATGCTTTATAAAAATACCCTAAAGCTAAATCTTACAATATTCTCAAG AACACAGTGAA ACAAGGCAAAATAAGTTAAAATCAACAAAAACAACATGAAACATAATTAGACACACAAAGACTTCAAACATTGGAAAATACCAGAGAAAGATAATAAATAT TTTACTCTTTAAAAATTTAGTTAAAAGCTTAAACTAATTGTAGAGAAAA AACTATGTTAGTATTATATTGTAGATGAAATAAGCAAAACATTTAAAATACAAATGTGATTACTTAAAT TAAATATAATAGATAATTTACCACCAGATTAGATACCATTGAAGGAATAATTAATATACTGAAATACAGGTCAGTAGAATTTTTTTCAATTCAGCATGGAGATGTAAAAAATGAAAA TTAATGCAAAAAATAAGGGCACAAAAAGAAATGAGTAATTTTGATCAGAAATGTATTAAAATTAATAAACTGGAAATTTGACATTTAAAAAAAGCATTGTCATCCAAGTAGATGTG TCTATTAAATAGTTGTTCTCATATCCAGTAATGTAATTATTATTCCCTCTCATGCAGTTCAGATTCTGGGGTAATCTTTAGACATCAGTTTTGTCTTTTATATTATTTATTCTGTTTACTAC ATTTTATTTTGCTAATGATATTTTTAATTTCTGACATTCTGGAGTATTGCTTGTAAAAGGTATTTTTAAAAATACTTTATGGTTATTTTTGTGATTCCTATTCCTCTATGGACACCAAGGCT ATTGACATTTTCTTTGGTTTCTTCTGTTACTTCTATTTTCTTAGTGTTTATATCATTTCATAGATAGGATATTCTTTATTTTTTATTTTTATTTAAATATTTGGTGATTCTTGGTTTTCTCAGCC ATCTATTGTCAAGTGTTCTTATTAAGCATTATTATTAAATAAAGATTATTTCCTCTAATCACATGAGAATCTTTATTTCCCCCAAGTAATTGAAAATTGCAATGCCATGCTGCCATGTGG TACAGCATGGGTTTGGGCTTGCTTTCTTCTTTTTTTTTTAACTTTTATTTTAGGTTTGGGAGTACCTGTGAAAGTTTGTTATATAGGTAAACTCGTGTCACCAGGGTTTGTTGTACAGATCA TTTTGTCACCTAGGTACCAAGTACTCAACAATTATTTTTCCTGCTCCTCTGTCTCCTGTCACCCTCCACTCTCAAGTAGACTCCGGTGTCTGCTGTTCCATTCTTTGTGTCCATGTGTTCTC ATAATTTAGTTCCCCACTTGTAAGTGAGAACATGCAGTATTTTCTAGTATTTGGTTTTTTGTTCCTGTGTTAATTTGCCCAGTATAATAGCCTCCAGCTCCATCCATGTTACTGCAAAGAA CATGATCTCATTCTTTTTTATAGCTCCATGGTGTCTATATACCACATTTTCTTTATCTAAACTCTTATTGATGAGCATTGAGGTGGATTCTATGTCTTTGCTATTGTGCATATTGCTGCAAG AACATTTGTGTGCATGTGTCTTTATGGTAGAATGATATATTTTCTTCTGGGTATATATGCAGTAATGCGATTGCTGGTTGGAATGGTAGTTCTGCTTTTATCTCTTTGAGGAATTGCCATG CTGCTTTCCACAATAGTTGAACTAACTTACACTCCCACTAACAGTGTGTAAGTGTTTCCTTTTCTCCACAACCTGCCAGCATCTGTTATTTTTTGACATTTTAATAGTAGCCATTTTAACT GGTATGAAATTATATTTCATTGTGGTTTTAATTTGCATTTCTCTAATGATCAGTGATATTGAGTTTGTTTTTTTTCACATGCTTGTTGGCTGCATGTATGTCTTCTTTTAAAAAGTGTCTGTT CATGTACTTTGCCCACATTTTAATGGGGTTGTTTTTCTCTTGTAAATTTGTTTAAATTCCTTATAGGTGCTGGATTTTAGACATTTGTCAGACGCATAGTTTGCAAATAGTTTCTCCCATTC TGTAGGTTGTCTGTTTATTTTGTTAATAGTTTCTTTTGCTATGCAGAAGCTCTTAATAAGTTTAATGAGATCCTGATATGTTAGGCTTTGTGTCCCCACCCAAATCTCATCTTGAATTATA TCTCCATAATCACCACATGGAGAGACCAGGTGGAGGTAATTGAATCTGGGGGTGGTTTCACCCATGCTGTTCTTGTGATAGTGAATGAGTTCTCACGAGATCTAATGGTTTTATGAGG GGCTCTTCCCAGCTTTGCCTGGTACTTCTCCTTCCTGCCGCTTTGTGAAAAAGGTGCATTGCGTCCCTTTCACCTTCTTCTATAATTGTAAGTTTCCTGAGGCCTTCCCAGCCATGCTGAA CTTCAAGTCAATTAAACCTTTTTCTTTATAAATTACTCAGTCTCTGGTGGTTCTTTATAGCAGTGTGAAAATGGACTAATGAAGTTCCCATTTATGAATTTTTGCTTTTGTTGCAATTGCTT TTGACATCTTAGTCATGAAATCCTTGCCTGTTCTAAGTACAGGACGGTATTGCCTAGGTTGTCTTCCAGGGTTTTTCTAATTTTGTGTTTTGCATTTAAGTGTTTAATCCATCTTGAGTTGA TTTTTGTATATTGTGTAAGGAAGGGGTCCAGTTTCAATCTTTTGCATATGGCTAGTTAGTTATCCCAGTACCATTTATTGAAAAGACAGTCTTTTCCCCATCGCTCGTTTTTGTCAGTTTT ATTGATGATCAGATAATCATAGCTGTGTGGCTTTATTTCTGGGTTCTTTATTCTGTTCTATTGGTTTATGTCCCTGTTTTTGTGCCAGTACCATGCTGTTTTGGTTAACATAGCCCTGTAGT ATAGTTTGAGGTCAGATAGCCTGATGCTTCCAGCTTTGTTCTTTTTCTTAAGATTGCCTTGGCTATTTGGCCTCTTTTTTGGTTCCACATGAATTTTAAAACAGTTGTTTCTAGTTTTTGAA GAATGTCATTGGTAGTTTGATAGAAATAGCATTTAATCTGTAAATTGATTTGTGCAGTATGGCCTTTTAATGATATTGATTCTTCCTATCCATGAGCATGATATGTTTTCCATTTTGTTTG TATCCTCTCTGATTTCTTTGTGCAGTGTTTTGTAATTCTCAT TGTAGAGATTTTTCACCTCCCTGGTTAGTTGTATTTTACCCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGAT TGCCTTCCTGATTTGACTGC CAGCTTGGTTACTGTTGGTTTATAGAAATGCTAGTGATTTTTGTACATTG ATTTTCTTTCTAAAACTTTGCTGAAGTTTTTTTTATTAGCAGAAGGAGCT TTGGGGCTGAGACTATGGGGTTTTCTAGATATAGAATCATGTCAGCTTCAAATAGGGATAATTTTACTTCCTCTCTTCCTATTTGGATGCCCTTTATTTCTTTCTCTTGCCTGATTACTCTG GCTGGGATTTCCTATGTTGAATAGGAGT CATGAGAGAGGGCATCAAATCTACACATATCAAATACTAACCTTGAATGTCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGAT 5000 bases per page How much data make up the human genome 3 pallets with 40 boxes per pallet x 5000 pages per box x 5000 bases per page = 3,000,000,000 bases! To get accurate sequence requires 6-fold coverage. Now: Shred 18 pallets in addition to reassemble.

The Beginning of the Project Most the first 10 years of the project were spent improving the technology to sequence in addition to analyze DNA. Scientists all around the world worked to make detailed maps of our chromosomes in addition to sequence model organisms, like worm, fruit fly, in addition to mouse. UC Santa Cruz gets Involved Computational biology (or Bioin as long as matics) is a research field that uses computers to help solve biological problems Because of the work Professor David Haussler was doing in the field of computational biology, UC Santa Cruz was invited to participate in the HGP in late of 1999. The Tech Awards honors the UCSC Genome Bioin as long as matics Group in 2003!

The Challenges were Overwhelming First there was the Assembly The DNA sequence is so long that no technology can read it all at once, so it was broken into pieces. There were millions of clones (small sequence fragments). The assembly process included finding where the pieces overlapped in order to put the draft together. 3,200,000 piece puzzle anyone Assembly generated by UCSC Freeze of sequence data generated by NCBI Clone layouts generated By Washington University ACCTTGG CCTGAAT CTAGGCT TTGCATC CCTAGTC CTGATCG sequence Clone maps Working draft assembly The “Working Draft” of the human genome UCSC put the human genome sequence on the web July 7, 2000 UCSC put the human genome sequence on CD in October 2000, with varying results Cyber geeks Searched as long as hidden Messages, in addition to “GATTACA”

The Completion of the Human Genome Sequence June 2000 White House announcement that the majority of the human genome (80%) had been sequenced (working draft). Working draft made available on the web July 2000 at genome.ucsc.edu. Publication of 90 percent of the sequence in the February 2001 issue of the journal Nature. Completion of 99.99% of the genome as finished sequence on July 2003. The Project is not Done Next there is the Annotation: The sequence is like a topographical map, the annotation would include cities, towns, schools, libraries in addition to coffee shops! So, where are the genes How do genes work And, how do scientists use this in as long as mation as long as scientific underst in addition to ing in addition to to benefit us What do genes do anyway We only have ~27,000 genes, so that means that each gene has to do a lot. Genes make proteins that make up nearly all we are (muscles, hair, eyes). Almost everything that happens in our bodies happens because of proteins (walking, digestion, fighting disease). Eye Color in addition to Hair Color are determined by genes OR OR

Of Mice in addition to Men: It’s all in the genes Humans in addition to Mice have about the same number of genes. But we are so different from each other, how is this possible One human gene can make many different proteins while a mouse gene can only make a few! Did you say cheese Mmm, Cheese! Genes are important By selecting different pieces of a gene, your body can make many kinds of proteins. (This process is called alternative splicing.) If a gene is “expressed” that means it is turned on in addition to it will make proteins. What we’ve learned from our genome so far There are a relatively small number of human genes, less than 30,000, but they have a complex architecture that we are only beginning to underst in addition to in addition to appreciate. -We know where 85% of genes are in the sequence. -We don’t know where the other 15% are because we haven’t seen them “on” (they may only be expressed during fetal development). -We only know what about 20% of our genes do so far. So it is relatively easy to locate genes in the genome, but it is hard to figure out what they do.

How do scientists find genes The genome is so large that useful in as long as mation is hard to find. Researchers at UCSC decided to make a computational microscope to help scientists search the genome. Just as you would use “google” to find something on the internet, researchers can use the “UCSC Genome Browser” to find in as long as mation in the human genome. Explore it at http://genome.ucsc.edu The UCSC Genome Browser The browser takes you from early maps of the genome

to a multi-resolution view at the gene cluster level the single gene level

Warren, Lou KVWM-AM Host www.phwiki.com

the single exon level in addition to at the single base level caggcggactcagtggatctggccagctgtgacttgacaag caggcggactcagtggatctagccagctgtgacttgacaag The Continuing Project Finding the complete set of genes in addition to annotating the entire sequence. Annotation is like detailing; scientists annotate sequence by listing what has been learn experimentally in addition to computationally about its function. Proteomics is studying the structure in addition to function of groups of proteins. Proteins are really important, but we don’t really underst in addition to how they work. Comparative Genomics is the process of comparing different genomes in order to better underst in addition to what they do in addition to how they work. Like comparing humans, chimpanzees, in addition to mice that are all mammals but all very different.

Who works on this stuff anyway Biologists in addition to Chemists underst in addition to the physical sciences-they take biology in addition to chemistry classes. Computer Scientists program the computers (the same people who make video games!)-they take math in addition to computer classes. Computer Engineers try to build better, faster, smarter computers-they take math, physics in addition to computer classes. Social Scientists try to underst in addition to how this new in as long as mation in addition to technology will impact our lives-they take sociology in addition to philosophy classes. UCSC Summer Workshop on Human Genome Research Held annually in July It’s a free event as long as students in addition to teachers Workshops by faculty in addition to researchers on a wide array of topics Tours of our laboratories in addition to kilocluster Free breakfast in addition to lunch Travel funds are available RSVP: 831-459-1702 or phoenix@soe.ucsc.edu How can I work on this project, or something like it Read about it, online at www.genome.gov, or in Nature, Science, or other scientific magazines. Take classes in biology, chemistry, math, physics in addition to English classes at high school. OR take classes at your local community college or University-Extension in biology, bioin as long as matics, or genetics. Go to college in addition to get a degree in science, engineering, math, or social sciences.

Bioin as long as matics Opportunities Entry-Level – Company National Laboratory Teaching – Private Schools BS (BA) MS (MA) Research Staff – Company/University National Laboratory Research Foundation Teaching – Community College Public Schools PhD Director/Professor – University Company National Laboratory Research Foundation Bioin as long as matics Biochemistry Biology Computer Science Computer Engineering Mathematics Ocean Sciences Physics (Education, Sociology, Philosophy, Psychology, Community Studies) A research degree in any of these majors will take you far! Thank you as long as letting us come talk to you today in addition to share what we do! Bye! Come to UCSC, Slugs are cool!

Warren, Lou Host

Warren, Lou is from United States and they belong to KVWM-AM and they are from  Lakeside, United States got related to this Particular Journal. and Warren, Lou deal with the subjects like Music

Journal Ratings by Carthage College

This Particular Journal got reviewed and rated by Carthage College and short form of this particular Institution is US and gave this Journal an Excellent Rating.